Table 1. e00101

Table 1. Primers used in PCR amplification of 5 exons of the human renalase gene

Primers	Structure of primer(5' → 3')
1Re-for	ggtcgggatccgatggcgcaggtgctgatcg
1Re-rev	cctgagtcgtcagccttgtcc
2Re-for	*ggacaaggctgacgactcagg*gggaagaatgactacagc
2Re-rev	cgttggtgttttttggcataatg
3Re-for	*cattatgccaaaaaacaccaacg*tttttatgatgaactgttagc
3Re-rev	ctgattctttcaagtaatgc
4Re-for	*gcattacttgaaagaatcag*gtgcagaagtctacttc
4Re-rev	aggtggtgatgtcaccttg
5Re-for	*caaggtgacatcaccacct*taattagtgaatgccaaaggc
5Re-rev	ctatattgcgcttcttattatc
6Re-for	*gataataagaacggcaatatag*agtcatcagaaattgggc
6Re-rev	cctgtgaatgtctccatttttgg
7Re-for	*ccaaaaatggagacattcacag*gttacaaatgctgctgcc
7Re-rev	gaggagctcgagaatataattctttaaagc

Примечание. In the structure of primers, nucleotides marked in italics and bold, determine the overlap region of adjacent exons. The flanking linker regions of the first exon primer (1Re-for) and the reverse primer of the seventh exon (7Re-rev) contained the BamHI and XhoI restriction sites respectively, (the restriction site nucleotides are shown in bold and underlined).