BMCRM e00175 Table 3.

Table 3. Primers used in PCR of the chimeric RNLS gene .

Primer	Primer sequence (5' → 3')
SP-PRL-for	ctggtc-ggatcc-gaaatggaa - aacatcaaaggatcgccatggaaa g-ggtccctcctgctgctgctg
SP-PRL-rev	ctgcctcctcagcagcgcgggggccacgctctggca c
Mat-RNLS-for	gcgctgctgaggagg cag acg
Mat-RNLS-rev	cagacg-ctc gag-ctaaatataattctttaaagcttc c

Note. In the primer structure, nucleotides shown in bold indicate the overlap region between the signal sequence encoded by the PRL gene and the template sequence of the RNLS gene. Underlined nucleotides represent BamHI and XhoI restriction sites. The Kozak sequence is shown in italics and in bold.