BMCRM e00194 Table 1.

Table 1. Sequences of primers used. The sequences are shown from 5’- to 3’-terminus. The asterisk in the primer sequence after “t” denotes thymidine with the attached fluorescein moiety (FAM) and in the primer name – the primer with fluorescein tags. The number in parenthesis in the primer name indicates the position of the last modified thymidine from the primer 3’-end.

Forward primer		Reverse primer
Primer name	Primer sequence	Primer name	Primer sequence
F	gctggccagtttgctacctt	R	acctccttcagtgcgaatcat
F*⁽¹⁾	gctggccagtttgctacctt*	R*⁽¹⁾	acctccttcagtgcgaatcat
F*⁽²⁾	gctggccagtttgctacctt	R*⁽⁴⁾	acctccttcagtgcgaat*cat
F*⁽⁶⁾	gctggccagtttgct*acctt	-	-