Table 1. Sequences of DNA oligonucleotides used as templates for the enzymatic synthesis of miRNAs and gRNAs.
Name |
Sequence (5’ → 3’) |
miR145-Т |
agggattcctgggaaaactggacccctatagtgagtcgtatta |
miR145-G |
gtccagttttcccaggaatccctgttttagtccccttcgtttttggggtagtctaaatcccctatagtgagtcgtatta |
miR218-T |
acatggttagatcaagcacaaccctatagtgagtcgtatta |
miR218-G |
ttgtgcttgatctaaccatgtgttttagtccccttcgtttttggggtagtctaaatcccctatagtgagtcgtatta |
miR34а-Т |
acaaccagctaagacactgccaccctatagtgagtcgtatta |
miR34а-G |
tggcagtgtcttagctggttgtgttttagtccccttcgtttttggggtagtctaaatcccctatagtgagtcgtatta |
T7F |
taatacgactcactataggg |
Note. The sequence of T7 RNA polymerase promoter is highlighted in bold, the sequences of gRNA spacers are underlined.